Skip to content
Logo of the University of Glasgow Logo of Glasgow Polyomics

Applications of Next-Generation Sequencing

Diagram illustrating selection of a subsequence of interest from a DNA sequence

DNA sequencing is the process of determining the order of nucleotides in a DNA molecule. Next generation sequencing (NGS) methods achieve this aim at unprecedented speed and very low cost. Entire genomes or transcriptomes can now be sequenced in a matter of days or weeks using 'second generation' sequencing methods: these involve the massively parallel sequencing of high number of spatially separated, amplified short DNA fragments.

The NGS facility at Glasgow Polyomics is equipped with several second-generation sequencing platforms to facilitate biological and medical research in the areas of genomics, transcriptomics, epigenomics and metagenomics.

Our Expertise

GenomicsTranscriptomicsEpigenomicsMetagenomics

Photograph of an Illumina MiSeq sequencing machine in the NGS lab

Free consultation on the experiment design and data analysis.

Whole genome sequencing of small to medium size genomes (MiSeq® or NextSeq™ 500 platforms)

Experiment:

  • sample QC
  • library preparation using Illumina kit e.g. TruSeq Nano, Nextera, or Nextera XT
  • sequencing to the agreed specification
  • raw data generation and QC

Bioinformatics support (collaborative basis):

  • de-novo assembly and genome annotation
  • or reference sequence based assembly followed by variant calling

Whole exome sequencing (NextSeq™ 500 platform)

Experiment:

  • sample QC
  • sequence capture and library preparation using e.g Nextera Rapid Capture kits
  • sequencing to the agreed specification
  • raw data generation and QC

Bioinformatics support (collaborative basis):

  • reference sequence based assembly followed by variant calling
Photograph of a NextSeq sequencing machine in the NGS lab

Free consultation on the experiment design and data analysis.

Whole Transcriptome Profiling (NextSeq™ 500 platform)

Experiment:

  • sample QC
  • library preparation using polyA selection (TruSeq stranded mRNA kit)
  • or library preparation using ribosomal depletion (TruSeq stranded totalRNA kits)
  • sequencing to the agreed specification (single- or paired-end, required number of fragments)
  • raw data generation and QC

Bioinformatics support (collaborative basis):

  • reference sequence based transcriptome assembly followed by expression quantification and differential expression analysis
  • or de-novo transcriptome assembly followed by expression quantification, differential expression analysis and transcript annotation
  • downstream analysis to the agreed specification e.g. biological network/pathways analysis

Small RNA Profiling (NextSeq™ 500 platform)

Experiment:

  • sample QC
  • library preparation using TruSeq stranded small RNA kit
  • sequencing to the agreed specification (single-end, required number of fragments)
  • raw data generation and QC

Bioinformatics support (collaborative basis)

  • adapter trimming
  • mapping reads to reference sequence
  • small RNA identification
  • expression quantification and differential analysis
Photograph of a NextSeq sequencing machine in the NGS lab

Free consultation on the experiment design and data analysis.

Chromatin Immuno-Precipitation Sequencing - ChIP-Seq (NextSeq™ 500 platform)

Experiment:

  • sample QC
  • library preparation using Illumina or NEB kits
  • sequencing to the agreed specification
  • raw data generation and QC

Bioinformatics support (collaborative basis):

  • analysis of protein binding sites
  • oranalysis of histone modification sites
Photograph of an Illumina MiSeq sequencing machine in the NGS lab

Free consultation on the experiment design and data analysis.

16S rRNA sequencing (MiSeq® platform)

Experiment:

  • sample QC
  • library preparation using Illumina dual index amplification within Fadrosh protocol or Illumina 16s protocol
  • or library preparation using LifeTechnoogies kit
  • sequencing to the agreed specification
  • raw data generation and QC

Bioinformatics support (collaborative basis):

  • analysis of taxonomic assignment of samples

Information on sample requirements.

Whole metagenomes sequencing (NextSeq™ 500 platform)

Experiment:

  • sample QC
  • library preparation using Illumina kits
  • sequencing to the agreed specification

Bioinformatics support (collaborative basis):

  • metagenome de-novo assembly and annotation

Checklist for Sample Delivery

Image showing laboratory samples in a plate
  1. Sample extraction should be carried out in the laboratory of the user.
  2. Check that you have packed and labelled your samples correctly for shipping.
  3. Check that your samples are accompanied by a completed NGS submission form or Bioanalyzer submission form as approriate.

FAQ Sheet

Preparing SamplesSending SamplesAnalysing SamplesOther

Does the facility carry out the RNA/DNA extraction?

No. We only accept samples that have already been extracted because there are a wide variety of extraction methods available and the researcher in charge of those samples is normally the best individual to select the optimal method. Additionally we do not have the facilities nor the resources to test or extract these different sample types.

How should I carry out the extractions?

RNA Sequencing

General: We prefer Column RNA extraction methods such as the Qiagen RNeasy kit. If your tissue requires Trizol extraction then we suggest that you clean up the RNA through a column post extraction.

For PolyA Selection library prep: DNase treatment of your samples is recommended e.g. using i.e Qiagen DNase 1. We require 1ug - 4µg of total RNA with RIN>=8.0

For Ribosomal Depletion library prep:(only possible for human, mouse , rat and possibly plant RNA) DNase treatment is essential. We require a minimum of 1ug of total RNA with a minimum concentration of 30ng/ul. This method is more amenable to partially degraded RNA. If you have other species you can perform ribosomal reduction yourself and we can prepare the library from this. For this option we need a minimum of 20ng of ribisoml depleted RNA.

For small RNA library prep:it is essential to make sure that the RNA extraction method retains small RNA e.g. using miRNeasy Mini Kit. Trizol extraction is good at retaining small RNA but you must ensure that the RNA is clean with a good 260/230 ratio of about 2. We require 2µg - 4µg of total RNA with RIN>=8.0.

Genome Sequencing

For our standard genome sequencing we require 1ug of clean genomic DNA with a 260/230 ratio of about 2.0. We recommend column purification. If you have much less sample we have other library prep options we can discuss with you. Please contact us for more information.

ChIP Sequencing

At present we require a minimum of 3ng of ChIP material tested with RT PCR for enrichment. The DNA needs to be clean preferably through a column clean up.

If you have problems reaching these requirements please contact us to discuss your options.

How many replicates do I need?

An absolute minimum of three biological replicates per sample is required. This should be increased to six or more replicates where sequencing is carried out on tissues (primary samples) where variability is greater.

Can I do my own library preparation?

Yes. But you must provide us with a minimum concentration of 4nM provide details on the concentration in ng/ul and a rough estimate of the library size and how it was prepared and any indexes if present details on the library. We will QC your libraries using RT-PCR before proceeding with sequencing. If any fail you will be contacted to provide replacements. If intending to prepare your own libraries please contact us first to discuss.

What information should I provide with my samples?

We kindly ask that the sample identification codes be sent along with the samples in Microsoft Excel® table using the appropriate sample submission form. Please include one printed list with the samples and also e-mail the file to our Executive Assistant at gp-sequencing@glasgow.ac.uk. In the table please include a unique code for each sample, as well as their position in the box or plate. We will run a batch of samples only if the samples and the sample list are matched. Please label all sample vials or plates clearly, using indelible ink.

How should I supply the samples?

Screw-capped would be ideal for transportation as they are less likely to leak. We will only accept samples that are supplied in a labelled sample box (e.g. 15cm x 15cm) or bag — this not only makes them easier to store for us, but also ensures they neither get mixed up in transit nor become difficult to find when we receive them. Please also label each tube clearly. When you fill in the sample submission form, please use the same labels as are on the tubes. For longer journeys especially, we would also suggest wrapping parafilm around the screw-top vials.

How should I ship the samples to you?

Before sending your samples please fill in the NGS submission form. This ensures that we have all the required information about your sample, including the analysis plan, and also makes sure that we are able to run the samples in a random order. It is important that the labelling on the sample tubes matches the labelling on the submitted sample file. Samples that are travelling to the facility from outside the University should be supplied in screw-capped tubes, to avoid leakage during transit.

Please ask us about recommended couriers for international delivery.

Please note that it is the responsibility of the user to ensure that the samples arrive at the facility. We would advise users to track the progress of their package daily.

Where should I send the samples?

Our postal address is:

Dr Pawel Herzyk
Sequencing Laboratory, Glasgow Polyomics
Wolfson Wohl Cancer Research Centre, Room 214-6
College of Medical, Veterinary & Life Sciences
University of Glasgow, Garscube Estate
Switchback Road
Bearsden G61 1QH
UK

Important: Please follow the correct procedure given above for packaging the samples.

I work in the University of Glasgow. Can I use internal mail to send the samples?

University of Glasgow users can deliver the samples to the Sequencing Laboratory using the internal mail system. Deliveries for Garscube leave Gilmorehill at 9:30 and 13:30 each working day from the basement of the Boyd Orr Building. It is not advised to send samples on a Friday afternoon as they might not reach the facility until the following Monday morning.

To prioritize the delivery of your samples, please mark the box clearly to indicate that it contains dry ice. Please enclose a printed copy of your sample submission form with your samples, and alert our Executive Assistant by email (gp-sequencing@glasgow.ac.uk) to let us know that the samples are on their way.

Can I deliver the samples in person?

Yes. If you are delivering your samples in person then please confirm a delivery time with a member of staff before travelling to the laboratory. As the building reception is manned only from 9:00–15:30, please do not attempt deliveries outside these times.

Can I do the analysis myself?

If you are happy to receive the raw reads then yes, we will deliver reads in the fastq format. If you require your data in another format please let us know at the outset of your project.

Example fast record for a single read:

@NS500205:44:H3JNFBGXX:1:11101:4908:13589 1:N:0:1

GTCTTCTTGGGGGTGGCTGCTGCCTTCTCCTCCTCTGAGTCATCACTGCTACTGCTGCTG

+

AAAAAFFFFFFFFAFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFAFFFFFFFF7

What is the cost per sample?

The cost depends on the type of work you are interested in, e.g. RNAseq, ChIPseq, 16S. It also depends on the number of samples and the amount of analysis required.

What is included in the cost per sample?

Depending on the parameters you chose, the cost includes QC of samples, library preparation, library QC, sequencing of the samples and conversion of raw data.

What is the cost for analysis?

The cost depends on the type of work you are interested in, e.g. RNAseq, ChIPseq, 16S. It also depends on the number of samples and the amount of analysis required.

What is included in the analysis?

The analysis is dependant on your experiment and can be tailored to your requirements. Ideally, this will be discussed and agreed prior to commencing the project.

How long does the analysis take?

The length of time depends on the type of work you are interested in, e.g. RNAseq, ChIPseq, 16S. It also depends on the number of samples and the amount of analysis required. You will be given a quote at the outset of the project.

What format do you use to return the analysed data?

The format of the analysed data is dependant on the type of analysis performed. If required, you will be instructed on how to interpret your data when it is delivered.

Can my student/post doc receive training on the instrumentation?

Only in very specific circumstances. In order to provide a high quality facility, it is essential that we limit access to the instrumentation to a handful of expert users.

Can I come to see the handling process and analysis?

Only in very specific circumstances. In order to provide a high quality facility, it is essential that we limit access to the instrumentation to a handful of expert users.